DNA Translation Tool (DNA to Protein)
Translate a DNA or RNA sequence into protein in any of the three forward or three reverse frames, using the standard or vertebrate mitochondrial genetic code.
Formula
- 0, 1 or 2 bases skipped at the start; frames −1 to −3 read the reverse complement
- a stop codon
How it works
The sequence is read three bases at a time from the start of the chosen frame, and each codon is looked up in the genetic code. A sequence has six possible frames: three on the strand as written and three on its reverse complement. Only one is normally a real protein-coding frame.
The standard code is NCBI translation table 1. The vertebrate mitochondrial code (table 2) differs: AGA and AGG are stop codons, ATA codes for methionine and TGA codes for tryptophan. Codons containing a base other than A, C, G or T are not translated, since they may stand for more than one amino acid.
Worked example
Translate ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG in frame +1 with the standard code.
- ATG GCC ATT GTA ATG GGC CGC TGA AAG GGT GCC CGA TAG.
- M A I V M G R * K G A R *.
MAIVMGR*KGAR*: 11 amino acids and two stop codons. The first stop ends the reading frame.
These are the values the calculator opens with, so you can check its output against this example.
Assumptions
- Translation starts at the first base of the frame, not at the first ATG. To find start codons use the ORF finder.
- The genetic code chosen matches the organism and compartment the sequence comes from.
- No selenocysteine or pyrrolysine recoding of stop codons is applied.
Common mistakes
- Translating a whole mRNA from base 1 instead of from the start codon, which gives a meaningless protein.
- Using the standard code for a mitochondrial gene, which turns TGA (tryptophan) into a stop.
- Forgetting that an intron-containing genomic sequence will not translate to a continuous protein.