DNA to RNA Converter (Transcription)
Convert DNA to RNA from either the coding or the template strand, RNA back to DNA, and RNA to complementary DNA, with the strand relationships explained.
Formula
- the DNA strand with the same sequence as the mRNA (also called the sense strand)
- the DNA strand that RNA polymerase reads, complementary to the mRNA
How it works
An mRNA has the same sequence as the coding strand of its gene, with uracil in place of thymine. RNA polymerase reads the other strand, the template, from 3′ to 5′, so the mRNA made is the reverse complement of the template written 5′ to 3′.
Reverse transcriptase does the opposite: it copies an RNA into a complementary DNA strand. The cDNA is the reverse complement of the RNA, written with T. The four conversions are shown together because confusing the coding and template strands is one of the most common sources of error in cloning and primer design.
Worked example
Transcribe the coding strand ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG.
- Replace every T with U.
AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG, 39 nucleotides.
These are the values the calculator opens with, so you can check its output against this example.
Assumptions
- Sequences are written 5′ → 3′.
- No splicing, editing, capping or polyadenylation is modelled. This is a base-for-base conversion.
Common mistakes
- Complementing without reversing. A complement written in the same left-to-right order is read 3′ → 5′.
- Using the template strand where the coding strand is meant when designing a probe or primer.
- Expecting the mRNA to equal the GenBank sequence for a gene on the minus strand. The record shows the plus strand; the mRNA may be its reverse complement.