Cas12a Target Finder

Find Cas12a target sites in a sequence on both strands: the TTTV PAM 5′ of the protospacer, the target, its GC content and the staggered cut position.

Result

Estimate

Target sites

With no flag: 2 of 2

Target sites
Strand	Position	Protospacer (5′ → 3′)	PAM	GC %	Cut after base	Flags
+	11–33	GACGTTAAGCTTCAGGATCCATG	TTTA	48	28	none
+	69–91	GAAGCTTCCAGGCTAGCCTGGAT	TTTG	57	86	none

Note

This is simple sequence matching. It lists where the PAM and a full-length protospacer occur in the sequence you pasted; it does not predict cutting efficiency and does not search a genome, so it says nothing about off-target sites elsewhere. Check candidates with a genome-wide off-target tool, and validate experimentally.

Note

Flags: TTTT ends transcription from U6 and other Pol III promoters; GC outside 40 to 80% is commonly associated with poorer guides.

Significant figuresScientific notation

Calculation

Staggered cut after the 18th base of the non-target strand and the 23rd of the target strand, downstream of the PAM.
Sites are found by matching the PAM on both strands. Positions are 1-based on the sequence as entered; "cut after base" is on the top strand.

Formula

\text{Cas12a PAM: TTTV (V = A, C or G) directly 5}'\text{ of the protospacer}

\text{cut: after the 18th base of the non-target strand and the 23rd of the target strand}

$\mathrm{PAM}$: TTTV, located on the 5′ side of the target
$\text{spacer}$: commonly 20 to 24 nt for Cas12a

How it works

Cas12a (Cpf1) differs from Cas9 in where its PAM lies: a T-rich TTTV sits on the 5′ side of the target, and the protospacer follows it. Cas12a also cuts differently, making a staggered double-strand break with a 5′ overhang and cutting distal to the PAM, where Cas9 cuts close to it.

The tool lists each TTTV and the protospacer after it on both strands, with the GC content and the position of the cut on the PAM-containing strand. As for Cas9, this is sequence matching only: it does not predict activity, and does not search a genome for off-target sites.

Worked example

An illustrative 106 bp sequence, Cas12a with a 23 nt spacer.

The first TTTV, TTTA, lies at bases 7 to 10, so the protospacer starts at base 11 and runs to base 33.
The cut on the PAM strand is after the 18th base of the protospacer, at base 28.

Two target sites, at 11 to 33 and 69 to 91, both on the top strand, with GC of 48% and 57%.

These are the values the calculator opens with, so you can check its output against this example.

Assumptions

Sequence matching only.
A 23 nt spacer by default. Spacer lengths from 20 to 24 nt are used, and the best depends on the enzyme.
Cut positions are those commonly described for AsCas12a and LbCas12a.

Common mistakes

Assuming a Cas9 guide design carries over. The PAM is on the other side, and the cut is distal to it.
Choosing a site whose PAM lies inside a stretch you plan to change, without checking that the edit destroys or keeps it as intended.
Relying on the tool without a genome-wide specificity check.

Cas9 Target Finder and PAM FinderFind PAM sites and protospacers for SpCas9, SpCas9-NG or SaCas9Open calculator Guide RNA (gRNA) AnalyzerLength, GC content and sequence features of a CRISPR guideOpen calculator Homology Arm CalculatorExtract left and right homology arms around an edit siteOpen calculator Reverse Complement ToolReverse, complement or reverse-complement a sequenceOpen calculator

Cas12a Target Finder

Result

Calculation

Formula

How it works

Worked example

Assumptions

Common mistakes

Related tools

Result

Calculation